View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_high_51 (Length: 282)
Name: NF1299_2D_high_51
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_high_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 43173737 - 43174004
Alignment:
| Q |
1 |
cctgatgtgtgtaaccagaaggttgcagatatcgttgaaaagggtagggtgcgccgtgtttatagaggagagagtgctcctcagattagagttaaatcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173737 |
cctgatgtgtgtaaccagaaggttgcagatatcgttgaaaagggtagggtgcgccgtgtttatagaggagagagtgctcctcagattagagttaaatcac |
43173836 |
T |
|
| Q |
101 |
tttcacatgaagaaccatcactggcttctgatgtttcaaatattgaagttgacactaagtcttctgaagattctgaaatttcttggttgggttcaactaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173837 |
tttcacatgaagaaccatcactggcttctgatgtttcaaatattgaagttgacactaagtcttctgaagattctgaaatttcttggttgggttcaactaa |
43173936 |
T |
|
| Q |
201 |
tttggcagttggtgcatctcaatctggtatgctgacttagttaatgctctttattaatattctgatgt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173937 |
tttggcagttggtgcatctcaatctggtatgctgacttagttaatgctctttattaatattctgatgt |
43174004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University