View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_high_53 (Length: 276)
Name: NF1299_2D_high_53
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 257
Target Start/End: Original strand, 2920464 - 2920711
Alignment:
| Q |
10 |
atgaattttgcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgaatgggaatgaggcacgatattcaaccgggttgttctct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
2920464 |
atgaattttgcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgagtgggaacgaggcacgatattcaaccgggctgttctct |
2920563 |
T |
|
| Q |
110 |
atcccgaaaggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgatcatgttgaattcctcaagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2920564 |
atcccgaaaggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgatcatgttgaattcctcaagt |
2920663 |
T |
|
| Q |
210 |
attattacactgaaaaaggccaaagagaccaatttgctatgcgcactt |
257 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2920664 |
attattacactgaaaaaggccaaagggaccaatttgctatgcgcactt |
2920711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 2935315 - 2935516
Alignment:
| Q |
13 |
aattttgcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgaatgggaatgaggcacgatattcaaccgggttgttctctatc |
112 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||| ||||| |||||||||||| ||||||||||||| |||||||| | ||||||||||||| | |
|
|
| T |
2935315 |
aattttgtaggcatggtcaaacgggaggttgcattcgccatttcacagggtgatgatgagtgggaatgaggcaagatattcagcagggttgttctctacc |
2935414 |
T |
|
| Q |
113 |
ccgaaaggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgatcatgttgaattcctcaagtatt |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||| ||||| |||||| | ||| ||||||||||||| |
|
|
| T |
2935415 |
cccaaaggagggtacattataaaagctccggaggagctggtggacgaggagcaccctttgctctttaagccttttgatcaagctgagttcctcaagtatt |
2935514 |
T |
|
| Q |
213 |
at |
214 |
Q |
| |
|
|| |
|
|
| T |
2935515 |
at |
2935516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University