View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_high_60 (Length: 253)
Name: NF1299_2D_high_60
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_high_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 383756 - 383992
Alignment:
| Q |
1 |
aaaagaatattttta-tttttaagttattaacatatgtctttaaaacacaagttagttagcatgacctatttaataattaataaacaaagaaactggctt |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
383756 |
aaaagaatatttttactttttaagttattaagatatgtttttaaaacacaagttagttagcatgacctatttaataatcaataaacaaagaaactggctt |
383855 |
T |
 |
| Q |
100 |
ttcaaaagcagaaaagggtcatacactatttttgtttgtttttgaggtaaggtacatacttattgctggctaaatttgggggaccaagcaataagctaat |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
383856 |
ttcaaaagc-taaaagggtcatacactatttttgtttgtttttgaggtaaggtacatacttattgctggctaaa-ttgggggaccaagcaataagctaat |
383953 |
T |
 |
| Q |
200 |
aaataccatgcttctaccattaagcaagaggtccatatt |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
383954 |
aaataccatgcttgtaccattaagcaagaggtccatatt |
383992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University