View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_high_61 (Length: 247)
Name: NF1299_2D_high_61
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_high_61 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 23 - 247
Target Start/End: Original strand, 31980724 - 31980948
Alignment:
| Q |
23 |
agcgtgagaagaaacaagagaaagagaaagaggaggttttgttcaacggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980724 |
agcgtgagaagaaacaagagaaagagaaagaggaggttttgttcaatggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaag |
31980823 |
T |
|
| Q |
123 |
atcgatgcaagagatggtggaggcgcgaccggagttgatggatgtgaaatcaaattggaacatcttgcatgagttgcttctttgttaccttgctctcaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980824 |
atcgatgcaagagatggtggaggcgcgaccggagttgatggatgtgaaatcaaattggaacatcttgcatgagttgcttctttgttaccttgctctcaac |
31980923 |
T |
|
| Q |
223 |
cccaagaatactcacaagttcattc |
247 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
31980924 |
ccaaagaatactcacaagttcattc |
31980948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 64 - 162
Target Start/End: Complemental strand, 38042481 - 38042383
Alignment:
| Q |
64 |
ttcaacggaagtgtggcagtaccaacctactcgcccgatccttatatggattttagaagatcgatgcaagagatggtggaggcgcgaccggagttgatg |
162 |
Q |
| |
|
||||||||||||||||| || ||||| || || || || ||||| ||||||||| |||| || ||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
38042481 |
ttcaacggaagtgtggcggtgccaacatattcaccggacccttacatggattttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatg |
38042383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University