View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_high_66 (Length: 225)
Name: NF1299_2D_high_66
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_high_66 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 6464780 - 6464570
Alignment:
| Q |
17 |
catttaggttagacaaatcattctaaagccgatgtgggtagttctttatggtcatgtatttagctaatgttctaaaa-tacatacatattgagttgtgtt |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
6464780 |
catttaggtttgacaaatcattctaaagccgatgtgggtagttttttatggtcatgtatttagctaatgttctaaaaatacatacatattgagctgtgtt |
6464681 |
T |
|
| Q |
116 |
tggtttattgcgggatagcccatt-tcttggtgagaataaagatggttgtgtgaatggttatcacttgtggacgcaaatgtttaccacgatacatagact |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6464680 |
tggtttattgcgggatagcccattgtcttggtgagaataaagatggttgtgtgaatggttatcacttgtggacgcaaatctttaccacgatacatagact |
6464581 |
T |
|
| Q |
215 |
tgcatgatttt |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
6464580 |
tgcatgatttt |
6464570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University