View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_109 (Length: 281)
Name: NF1299_2D_low_109
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_109 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 63 - 267
Target Start/End: Original strand, 43173800 - 43174004
Alignment:
| Q |
63 |
agaggagagagtgctcctcagattagagttaaatcactttcacatgaagaaccatcactggcttctgatgtttcaaatattgaagttgacactaagtctt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173800 |
agaggagagagtgctcctcagattagagttaaatcactttcacatgaagaaccatcactggcttctgatgtttcaaatattgaagttgacactaagtctt |
43173899 |
T |
 |
| Q |
163 |
ctgaagattctgaaatttcttggttgggttcaactaatttggcagttggtgcatctcaatctggtatgctgacttagttaatgctctttattaatattct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173900 |
ctgaagattctgaaatttcttggttgggttcaactaatttggcagttggtgcatctcaatctggtatgctgacttagttaatgctctttattaatattct |
43173999 |
T |
 |
| Q |
263 |
gatgt |
267 |
Q |
| |
|
||||| |
|
|
| T |
43174000 |
gatgt |
43174004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 43173761 - 43173695
Alignment:
| Q |
1 |
caaccttctggttacacacatcaggacctgaatttataagatcataaacatgattccaaaagagagg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173761 |
caaccttctggttacacacatcaggacctgaatttataagatcataaacatgattccaaaagagagg |
43173695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University