View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_117 (Length: 260)
Name: NF1299_2D_low_117
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_117 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 24 - 255
Target Start/End: Original strand, 5474575 - 5474806
Alignment:
| Q |
24 |
gataatgatacgggaaagcatataaaaaagaggatacaattcaaagaaaaaacattttctcatacaaggtgttcagtgaaagtttatgtcactttatttt |
123 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
5474575 |
gataaggatacgggaaagcatataaaaaacaggatacaattcaaagaaaaaacattctctcatacaaggtgtttagtgaaagtt--tgtcactttatttt |
5474672 |
T |
 |
| Q |
124 |
caaaactgtttagatcctccattgtaagaaacacaa--nnnnnnnnnccgttcatattggaaactaccttgaaacaagcagaatgaaactgctagtagca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5474673 |
caaaactgtttagatcctccattgtaagaaacacaatttttgtttttccgttcatattgaaaactaccttgaaacaagcagaatgaaactgctagtagca |
5474772 |
T |
 |
| Q |
222 |
ttgttattcataaaacatgtcttaccaacaacac |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5474773 |
ttgttattcataaaacatgtcttaccaacaacac |
5474806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University