View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_122 (Length: 254)
Name: NF1299_2D_low_122
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_122 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 29 - 237
Target Start/End: Complemental strand, 14736776 - 14736568
Alignment:
| Q |
29 |
ctatcataattgtacatgtcgaactgtcaaaccactgcaccaacatgcctgagtatctaaaattgtctgaatatcttgaacataatttattaatcctgaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
14736776 |
ctatcataattgtacatgtcgaactgtcaaaccactgcaccaacatgcctgagtatctaaaattgtctgaatatcttcaacataatttattaatcctg-a |
14736678 |
T |
 |
| Q |
129 |
aatttttcgaaattcccaact-aaagtgtaaccacaggaacacatgtcctcctttaccgagttctaaaggtatctgcctcttacttgtgtaacttgcctg |
227 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14736677 |
aacttttcgaaattcccaactaaaagtgtaaccacaggaacacatgtcctcctttaccgagttctaaaggtatctgcctcttacttgtgtaacttgcgtg |
14736578 |
T |
 |
| Q |
228 |
acgaccctgt |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
14736577 |
acgaccctgt |
14736568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University