View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_129 (Length: 243)
Name: NF1299_2D_low_129
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_129 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 84 - 221
Target Start/End: Original strand, 15618767 - 15618926
Alignment:
| Q |
84 |
agggctagaggaactataaatacaaggctcgggttttggtgaggggggaaagatgttagtctt----------------------aagaaagcgtttgtg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15618767 |
agggctagaggaactataaatacaaggctcgggttttggtgaggggggaaagatgttagtcttggagaaccaatagaggatttttaagaaagcgtttgtg |
15618866 |
T |
 |
| Q |
162 |
ccttttagggagggattcataggctagaaacacatgagaggtgagagtgagacaaactat |
221 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15618867 |
ccttttagggagggattcataagctagaaacacatgagaggtgagagtgagacaaactat |
15618926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 15618687 - 15618731
Alignment:
| Q |
4 |
cctatctcgtggcatggaggaaatggattgtgacgtagacaagta |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15618687 |
cctatctcgtggcatggaggaaatggattgtgacgtagacaagta |
15618731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University