View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_143 (Length: 217)
Name: NF1299_2D_low_143
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_143 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 89 - 217
Target Start/End: Original strand, 27097199 - 27097327
Alignment:
| Q |
89 |
gcaggacacaatgttggttcctaaatggctcaaaccacttcttagcacaccatttttcaatgagtgtcggattcacgccgacgccgcgaggagtgaatgt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27097199 |
gcaggacacaatgttggttcctaaatggctcaaaccacttcttagcacaccatttttcaatgagtgtcggattcacgccgacgccgcgaggagtgaatgt |
27097298 |
T |
|
| Q |
189 |
aacatgttttgtctagattgcaatgttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27097299 |
aacatgttttgtctagattgcaatgttga |
27097327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 27097130 - 27097177
Alignment:
| Q |
8 |
tatacacatatgttataacttattgtgatttaaatttaatatgttcat |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27097130 |
tatacacatatgttataacttattgtgatttaaatttaatatgttcat |
27097177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University