View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_148 (Length: 209)
Name: NF1299_2D_low_148
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_148 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 7 - 206
Target Start/End: Original strand, 38838256 - 38838453
Alignment:
| Q |
7 |
gccaccccaataataatacattttctacaagnnnnnnnncaagaggacgttttctacaagttgtgagcttaaaagatnnnnnnntaaactcttaataatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
38838256 |
gccaccccaataataatacattttctacaagttttttt-ctagaggacgttttctacaagttgtgagcttaaaagataaaaaaataaactcttaatattt |
38838354 |
T |
 |
| Q |
107 |
tcttttctttgatgttattttttgttaccattttgacatcttattcatcggtggtgaggaatttcgacggcaaattcaactgatgttgatgagcatgcac |
206 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
38838355 |
t-ttttctttgatgttattttttgttagcattttgacatcttattcatcggtggtgaggaatttcgacggaaaattcagctgatgttgatgagcatgcac |
38838453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University