View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_153 (Length: 207)
Name: NF1299_2D_low_153
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_153 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 19 - 123
Target Start/End: Complemental strand, 36611083 - 36610979
Alignment:
| Q |
19 |
aaatatgcattatgatgtgcccatgtcacttgagttattggtgggtgttggagggtttgaggaggattttgcccaatccagggttttttaatggagatgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
36611083 |
aaatatgcattatgatgtgcccatgtcacttgagttattggtgggtgttggagggtttgaggaggattttgcccaatcccgtgttttttaatggagatgt |
36610984 |
T |
 |
| Q |
119 |
tgatt |
123 |
Q |
| |
|
||||| |
|
|
| T |
36610983 |
tgatt |
36610979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 118 - 207
Target Start/End: Original strand, 36610822 - 36610911
Alignment:
| Q |
118 |
ttgattaagacatttacacaagagtttgattcacgatatgagtggcacgcccaattctctctatccatattcaacaaacgcataatcttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36610822 |
ttgattaagacatttacacaagagtttgattcacgatatgagtggcacgtccaattctctctatccatattcaacaaacacataatcttt |
36610911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University