View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_79 (Length: 349)
Name: NF1299_2D_low_79
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 202 - 330
Target Start/End: Original strand, 39845263 - 39845391
Alignment:
| Q |
202 |
aactgtctgtatttgtttccaagcccctttgatatttggaatactttttccacatctgagagtggttttccaaatctgcaagttggtcacacgtatcttt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39845263 |
aactgtctgtatttgtttccaagcccctttgatatttggaatactttttccacatctgagagtggttttccaaatctgcaagttggtcacacgtatcttt |
39845362 |
T |
 |
| Q |
302 |
gaattttctaatttactacaaagtacaat |
330 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
39845363 |
gaattttctaatttactactaagtacaat |
39845391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 29 - 126
Target Start/End: Original strand, 6379624 - 6379720
Alignment:
| Q |
29 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaatacaggacagtgaaaacactttcgttcctgtc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||| ||||||||| ||||||||| |
|
|
| T |
6379624 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaagatatgacagtg-aaacactttggttcctgtc |
6379720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 29 - 126
Target Start/End: Original strand, 6384315 - 6384411
Alignment:
| Q |
29 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaatacaggacagtgaaaacactttcgttcctgtc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||| ||||||||| ||||||||| |
|
|
| T |
6384315 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaagatatgacagtg-aaacactttggttcctgtc |
6384411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 29 - 126
Target Start/End: Complemental strand, 1617437 - 1617341
Alignment:
| Q |
29 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaatacaggacagtgaaaacactttcgttcctgtc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||| ||||||||| ||||||||| |
|
|
| T |
1617437 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaagatatgacagtg-aaacactttggttcctgtc |
1617341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 29 - 126
Target Start/End: Complemental strand, 1622129 - 1622033
Alignment:
| Q |
29 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaatacaggacagtgaaaacactttcgttcctgtc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||| ||||||||| ||||||||| |
|
|
| T |
1622129 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaagatatgacagtg-aaacactttggttcctgtc |
1622033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 29 - 125
Target Start/End: Original strand, 42574256 - 42574351
Alignment:
| Q |
29 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaatacaggacagtgaaaacactttcgttcctgt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||| ||||||||| |||||||| |
|
|
| T |
42574256 |
taggcttgactttagggattttgataggaaaactctgtatatatgtaacactgatttacaatgaaagatatgacagtg-aaacactttggttcctgt |
42574351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University