View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1299_2D_low_81 (Length: 348)

Name: NF1299_2D_low_81
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1299_2D_low_81
NF1299_2D_low_81
[»] chr5 (1 HSPs)
chr5 (18-338)||(43092399-43092719)
[»] chr3 (1 HSPs)
chr3 (178-275)||(23879494-23879591)


Alignment Details
Target: chr5 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 43092399 - 43092719
Alignment:
18 atatggaagttcttctacggattttacgtagtaggaatgcagaccgtcgttgtcttcggcaccaaaaccgactttgccaccttttaggtttgtgatattc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43092399 atatggaagttcttctacggattttacgtagtaggaatgcagaccgtcgttgtcttcggcaccaaaaccgactttgccaccttttaggtttgtgatattc 43092498  T
118 acgtaaccggcggttccagcggcggatccggtggcttggaacatggaggagacaagtgtggtgccgtcggtgatttggtggagtttcttggcgccgaagt 217  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43092499 acgtaaccggcggttccagcggcggatccagtggcttggaacatggaggagacaagtgtggtgccgtcggtgatttggtggagtttcttggcgccgaagt 43092598  T
218 agtcgactaaaacatggagggagaggacatttttgagggtggtgatggagaggtgtttgtctaggagggaggacatggcggcattgtctatggctaggat 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43092599 agtcgactaaaacatggagggagaggacatttttgagggtggtgatggagaggtgtttgtctaggagggaggacatggcggcattgtctatggctaggat 43092698  T
318 ggttatggtttgacggcggtt 338  Q
    |||||||||||||||||||||    
43092699 ggttatggtttgacggcggtt 43092719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 275
Target Start/End: Complemental strand, 23879591 - 23879494
Alignment:
178 gtgccgtcggtgatttggtggagtttcttggcgccgaagtagtcgactaaaacatggagggagaggacatttttgagggtggtgatggagaggtgttt 275  Q
    ||||||| |||||||||||| || || ||||||||||||||||| |  |  || |||||||||||||  ||||||| |||| | || || ||||||||    
23879591 gtgccgttggtgatttggtgaagctttttggcgccgaagtagtcaaggaggacgtggagggagaggatgtttttgatggtgtttattgaaaggtgttt 23879494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University