View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_81 (Length: 348)
Name: NF1299_2D_low_81
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 43092399 - 43092719
Alignment:
| Q |
18 |
atatggaagttcttctacggattttacgtagtaggaatgcagaccgtcgttgtcttcggcaccaaaaccgactttgccaccttttaggtttgtgatattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43092399 |
atatggaagttcttctacggattttacgtagtaggaatgcagaccgtcgttgtcttcggcaccaaaaccgactttgccaccttttaggtttgtgatattc |
43092498 |
T |
 |
| Q |
118 |
acgtaaccggcggttccagcggcggatccggtggcttggaacatggaggagacaagtgtggtgccgtcggtgatttggtggagtttcttggcgccgaagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43092499 |
acgtaaccggcggttccagcggcggatccagtggcttggaacatggaggagacaagtgtggtgccgtcggtgatttggtggagtttcttggcgccgaagt |
43092598 |
T |
 |
| Q |
218 |
agtcgactaaaacatggagggagaggacatttttgagggtggtgatggagaggtgtttgtctaggagggaggacatggcggcattgtctatggctaggat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43092599 |
agtcgactaaaacatggagggagaggacatttttgagggtggtgatggagaggtgtttgtctaggagggaggacatggcggcattgtctatggctaggat |
43092698 |
T |
 |
| Q |
318 |
ggttatggtttgacggcggtt |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43092699 |
ggttatggtttgacggcggtt |
43092719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 275
Target Start/End: Complemental strand, 23879591 - 23879494
Alignment:
| Q |
178 |
gtgccgtcggtgatttggtggagtttcttggcgccgaagtagtcgactaaaacatggagggagaggacatttttgagggtggtgatggagaggtgttt |
275 |
Q |
| |
|
||||||| |||||||||||| || || ||||||||||||||||| | | || ||||||||||||| ||||||| |||| | || || |||||||| |
|
|
| T |
23879591 |
gtgccgttggtgatttggtgaagctttttggcgccgaagtagtcaaggaggacgtggagggagaggatgtttttgatggtgtttattgaaaggtgttt |
23879494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University