View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_89 (Length: 312)
Name: NF1299_2D_low_89
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_89 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 3 - 294
Target Start/End: Complemental strand, 8259576 - 8259285
Alignment:
| Q |
3 |
agtttggtgtttaatggctacagttgctggccggttggaaaagatgttgtcttgaacttgcagaacttgtcgtgcggcatccgcgtcggaaatagctacc |
102 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8259576 |
agttaggtatttaatggctacagttgctggccggttggaaaagatgttgtcttgaacttgcagaacttgtcgtgcggcatccgcgtcggaaatagctacc |
8259477 |
T |
 |
| Q |
103 |
atgtggaggaatcccatgcgtaggtgaaagatgccaccatattttttggctaagttggctagaccacggtgggttaattggtccatcattaacatgttac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8259476 |
atgtggaggaatcccatgcgtaggtgaaagatgccaccatattttttggctaagttggctagaccacggtgggttaattggtccatcattaacatgttac |
8259377 |
T |
 |
| Q |
203 |
ctataacaggtaaccctattggtcctggtggatatcttggtcttttgaggattcgtgacactaaacccaacaagagtattagtggtacgatg |
294 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8259376 |
ctataataggtaaccctattggtcctggtggatatcttggtcttttgaggattcgtgacactaaacccaacaagagtattagtggtacgatg |
8259285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University