View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1299_2D_low_94 (Length: 304)

Name: NF1299_2D_low_94
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1299_2D_low_94
NF1299_2D_low_94
[»] chr2 (1 HSPs)
chr2 (1-301)||(37054401-37054701)


Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 37054401 - 37054701
Alignment:
1 aaatgtctcaagatgcagcaaacagttctcagcagacaccacagaaccttgctgacacagttaatgctattgcagctgatcctaacttcactgcagcttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37054401 aaatgtctcaagatgcagcaaacagttctcagcagacaccacagaaccttgctgacacagttaatgctattgcagctgatcctaacttcactgcagcttt 37054500  T
101 agcagctgctattacttcaattattggggcggcgcagccaaacaataacaacggtactagcaataatggtaacggtacaatagctaataacagtaatggc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37054501 agcagctgctattacttcaattattggggcggcgcagccaaacaataacaacggtactagcaataatggtaacggtacaatagctaataacagtaatggc 37054600  T
201 aatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcccaactcttcagtagagtagctagctcacaaagtgataacttcatatcagt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
37054601 aatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcccaactcttcagtagagtagctagctcacaaagtgataacttcatagcagt 37054700  T
301 c 301  Q
    |    
37054701 c 37054701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University