View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1299_2D_low_94 (Length: 304)
Name: NF1299_2D_low_94
Description: NF1299_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1299_2D_low_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 37054401 - 37054701
Alignment:
| Q |
1 |
aaatgtctcaagatgcagcaaacagttctcagcagacaccacagaaccttgctgacacagttaatgctattgcagctgatcctaacttcactgcagcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054401 |
aaatgtctcaagatgcagcaaacagttctcagcagacaccacagaaccttgctgacacagttaatgctattgcagctgatcctaacttcactgcagcttt |
37054500 |
T |
 |
| Q |
101 |
agcagctgctattacttcaattattggggcggcgcagccaaacaataacaacggtactagcaataatggtaacggtacaatagctaataacagtaatggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054501 |
agcagctgctattacttcaattattggggcggcgcagccaaacaataacaacggtactagcaataatggtaacggtacaatagctaataacagtaatggc |
37054600 |
T |
 |
| Q |
201 |
aatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcccaactcttcagtagagtagctagctcacaaagtgataacttcatatcagt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37054601 |
aatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcccaactcttcagtagagtagctagctcacaaagtgataacttcatagcagt |
37054700 |
T |
 |
| Q |
301 |
c |
301 |
Q |
| |
|
| |
|
|
| T |
37054701 |
c |
37054701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University