View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300-Insertion-3 (Length: 206)
Name: NF1300-Insertion-3
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300-Insertion-3 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 63 - 206
Target Start/End: Complemental strand, 1695657 - 1695517
Alignment:
| Q |
63 |
gtgatttatttcgaaagacacttgcactataagttttcaataacataaggatgtgactgatttcataaggaaaaagtatttttgactaattgcatgtgga |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1695657 |
gtgatttatttcgaaagacacttgcactataagttttcaataacataaggatgtgactg---tgataaggaaaaagtatttttgactaattgcatgtgga |
1695561 |
T |
|
| Q |
163 |
tttaagaactaatacactataaacacttattagacatttggtta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1695560 |
tttaagaactaatacactataaacacttattagacatttggtta |
1695517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 36
Target Start/End: Complemental strand, 1695690 - 1695661
Alignment:
| Q |
7 |
actttctataacactatttggatgaaagat |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1695690 |
actttctataacactatttggatgaaagat |
1695661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University