View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1300-Insertion-6 (Length: 161)
Name: NF1300-Insertion-6
Description: NF1300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1300-Insertion-6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 34607905 - 34608058
Alignment:
| Q |
8 |
gaaaagtgtagggtgttgcattatatgagccaaatagaggttgaattgatcgaagctataggtggaagtaggacacctggtttttgaaatgttgcaaggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34607905 |
gaaaagtgtagggtgttgcattatatgagccaaatagaggttgaattgatcgaagctataggtggaagtaggacacctggtttgtgaaatgttgcaaggt |
34608004 |
T |
 |
| Q |
108 |
agccacgtcgctatataagatgatgactactcactttcatttttggttctttga |
161 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34608005 |
agccacgtcgttatataagatgatgactactcactttcatttttggttctttga |
34608058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University