View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_high_29 (Length: 265)
Name: NF13000_high_29
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 45145878 - 45146111
Alignment:
| Q |
18 |
catttatttggtgagaaattaggatggtccacattttattttgtttttgagaagcaaagtagcttagctatattcgttggtggcattaagaaggtccctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45145878 |
catttatttggtgagaaattaggatggtccacattttattttgtttttgagaagcaaagtagcttagctatattcgttggtggcattaagaaggtccctc |
45145977 |
T |
|
| Q |
118 |
cgttttctttttccaacttccttgtcttttgcaactcttgttcatcatcttccttcaatttctgtctctttattttggacccaaataataatacattcaa |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45145978 |
cgttttctttttctaacttccttgtcttttgcaactcttgttcatcatcttccttcaatttctgtctctttattttggacccaaataataatacattcaa |
45146077 |
T |
|
| Q |
218 |
aaattcattccatttttatttttgtcggcacatct |
252 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
45146078 |
aaattcattcca-ttttatttttgtcggcacatct |
45146111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University