View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_high_34 (Length: 238)
Name: NF13000_high_34
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 39097880 - 39098108
Alignment:
| Q |
1 |
tttttctgtttcattgctttttgtagttcaataatggttgttgatgaggcttctcataacaagccagggttttgtcgtcaagactccaaatcggacttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39097880 |
tttttctgtttcattgctttttgtagttcaataatggttgttgatgaggcttctcataacaagccagggttttgtcgtcgagactccaaatcggacttta |
39097979 |
T |
|
| Q |
101 |
atgtccctttttctgcaaggttatcatcgtcaaatttgagtttgagaaaatgtagcagtaactttgatgaatctgttcagaagagggatactactacaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39097980 |
atgtccctttttctgcaaggttatcatcgtcaaatttgagtttgagaaaatgtagtagtaactttgatgaatctgttcagaagagggatactactacaat |
39098079 |
T |
|
| Q |
201 |
gtcagctaagaggtcttttgttgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39098080 |
gtcagctaagaggtcttttgttgatgatg |
39098108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 187 - 229
Target Start/End: Original strand, 39103879 - 39103921
Alignment:
| Q |
187 |
gatactactacaatgtcagctaagaggtcttttgttgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39103879 |
gatactactacaatgtcagctaagaggtcttttgttgatgatg |
39103921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 143 - 213
Target Start/End: Original strand, 32984734 - 32984804
Alignment:
| Q |
143 |
tgagaaaatgtagcagtaactttgatgaatctgttcagaagagggatactactacaatgtcagctaagagg |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
32984734 |
tgagaaaatgtagcagtagctttgatgagtctgttcagaagagggatactactacactgtcagttaagagg |
32984804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University