View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_high_37 (Length: 225)
Name: NF13000_high_37
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_high_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 33203946 - 33203742
Alignment:
| Q |
1 |
caacggcgaaccattaacagctttttcagcaatctctttcataagagaagcgtattgaattccaagaccaatttcaaaatcaacaacgtgcatgtataac |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203946 |
caacggcgaaccgttaacagctttttcagcaatctctttcataagagaagcgtattgaattccaagaccaatttcaaaatcaacaacgtgcatgtataac |
33203847 |
T |
|
| Q |
101 |
gatccatgcaacgcttcgagtaacgcttggttggttgtgaaaatagaaaacattggaataggtgaaattccagaaaaggccttgaaggttcttatggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203846 |
gatccatgcaacgcttcgagtaacgcttggttcgttgtgaaaatagaaaacattggaataggtgaaattccagaaaaggccttgaaggttcttatggttt |
33203747 |
T |
|
| Q |
201 |
gaaca |
205 |
Q |
| |
|
||||| |
|
|
| T |
33203746 |
gaaca |
33203742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University