View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_low_16 (Length: 327)
Name: NF13000_low_16
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 109 - 318
Target Start/End: Original strand, 47639750 - 47639959
Alignment:
| Q |
109 |
ctcttgaataaatgaagttgttaaaaagataatcacaacacgatgttggggacattgctttgttaatgttcaatatacatcaaggaaaatgaaacatata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639750 |
ctcttgaataaatgaagttgttaaaaagataatcacaacacgatgttggggacattgctttgttaatgttcaatatacatcaaggaaaatgaaacatata |
47639849 |
T |
|
| Q |
209 |
gggaccattgatcattccctttcttctctttgttggtctctttaattttggaatacaaactccattattcatgttggtgtgtggattactaaactaatgg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639850 |
gggaccattgatcattccctttcttctctttgttggtctctttaattttggaatacaaactccattattcatgttggtgtgtggattactaaactaatgg |
47639949 |
T |
|
| Q |
309 |
ttcttctttt |
318 |
Q |
| |
|
|||||||||| |
|
|
| T |
47639950 |
ttcttctttt |
47639959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 47639692 - 47639748
Alignment:
| Q |
8 |
aattatgtatcatcaaagctaatcaaatttaattaaggtgttgaatacaatgtctct |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639692 |
aattatgtatcatcaaagctaatcaaatttaattaaggtgttgaatacaatgtctct |
47639748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University