View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_low_19 (Length: 322)
Name: NF13000_low_19
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 33970342 - 33970151
Alignment:
| Q |
18 |
actatttatggtctttaaccattatcccgaagatactggttaacatttttcatatacattt-gatatgatctttgaggaaatgtgttcattcacttcacg |
116 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
33970342 |
actatttatgatccttaaccattgtcccgaagatactagttaacattttccatatacattttgatatgatgtttgaggaaatgtattcattcacttcacg |
33970243 |
T |
|
| Q |
117 |
gatcatttttgttttgaccaaacacttcacggaccattttattaacttgtcttttggggaggctaattaatgcatttagttgaattttcttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33970242 |
gatcatttttgttttgaccaaacacttcacggaccattttattaacttgtcttttggggaggctaattaatgcatttagttgaattttcttt |
33970151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 251 - 319
Target Start/End: Complemental strand, 33970122 - 33970054
Alignment:
| Q |
251 |
aagaaagaatttgtgtccttttgaatgttgctatcacctcataattatgtgatgtaagtactttagcat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33970122 |
aagaaagaatttgtgtccttttgaatgttgctatcacctcataattatgtgatgtaagtactttagcat |
33970054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University