View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_low_23 (Length: 299)
Name: NF13000_low_23
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 283
Target Start/End: Complemental strand, 43213125 - 43212864
Alignment:
| Q |
16 |
aatataagtcgtggagatactttaaaatgtctattgataataaaagatttgattatggtagttatgtaaatgttgatgattttactattaaaatttattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43213125 |
aatataagtcgtggagatactttaaaatgtctattaataatcaaagatttgattatggtagttatgt------tgatgattttactattaaaatttattc |
43213032 |
T |
 |
| Q |
116 |
gtannnnnnnattgatgaaatgtagagtatgaaaggattcaaatccataaaaattacattatatcaatcacttacttcttgtttccttcatcaaaatggc |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213031 |
gtatttttttattgatgaaatgtagagtatgaaaggattcaaatccataaaaattacattatatcaatcacttacttcttgtttccttcatcaaaatggc |
43212932 |
T |
 |
| Q |
216 |
tacctttgagtgacttagcagctcaaccccagttcaaatcaaaagatctgaatcaataatcaagtttg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43212931 |
tacctttgagtgacttagcagctcaaccccagttcaaatcaaaagatctgaatcaataatcaagtttg |
43212864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University