View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_low_24 (Length: 294)
Name: NF13000_low_24
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 5 - 279
Target Start/End: Original strand, 39851650 - 39851924
Alignment:
| Q |
5 |
cacatcgatagaaataactaacacatgtaagttacactaaacttgtcgcaccggacatgtcggcttgtttaggttgatttttggctaattacaaagtgtg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
39851650 |
cacatcgatagaaataactaacacatgtaagttacactaaacatgtcgcaccgaacatgtcagcttgtttaggttgattttttgttaattacaaagtgtg |
39851749 |
T |
 |
| Q |
105 |
ccaaattgatcacaaacgaatgtttaatcaatgtgatgcgatcacaagatcttgtacgagttaattggtaatctaagaagctttacgtgcatgtgtgagt |
204 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
39851750 |
ccaaatttatcacaaacgaatgtttaatcaatgtgatgcgatcacaagatcttgtacgagttaattggtaacctaagaagctttatgtgcatgtgtgagt |
39851849 |
T |
 |
| Q |
205 |
tttaatgaggtgttttggttaaataaaatgtgactttgatgtgaattttagagaacaaacaacgacacacaaatt |
279 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39851850 |
ttttatgaggtgttttggttaaataaaatgtgagtttgatgtgaattttaaagaacaaacaacgacacacaaatt |
39851924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University