View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_low_25 (Length: 294)
Name: NF13000_low_25
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 33399370 - 33399097
Alignment:
| Q |
1 |
caaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattcaaaacgattcacaggaatctgataactgtttgagattggattagttc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399370 |
caaatgcaccatggaccgctccccgccggtccctgctgcaaaagtagctattcaaaacgattcacaggaatctgataactgtttgagattggattagttc |
33399271 |
T |
 |
| Q |
101 |
atgtgtcatgtttcaaagtggggctattttttctagtgactaaaatcattaattatttattttctttatgttggtgaatttatttacacacataaataaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399270 |
atgtgtcatgtttcaaagtggggctattttttctagttactaaaatcattaattatttattttctttatgttggtgaatttatttacacacataaataaa |
33399171 |
T |
 |
| Q |
201 |
aagaatcacacgtttcctagtgatgatttcaaatctgatcttatagctcttcctgaatttcttacaatggggtt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399170 |
aagaatcacacgtttcctagtgatgatttcaaatctgatcttatagctcttcctgaatttcttacaatggggtt |
33399097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 33395486 - 33395394
Alignment:
| Q |
1 |
caaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattcaaaacgattcacaggaatctgataactgtttgagattgga |
93 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| |||| ||||||||||||||||| ||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
33395486 |
caaatgcaccatggaccgctgcccgccggtccctactgccaaagaagctattcaaaatgattcacagaaatttgatagctgtttgagattgga |
33395394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University