View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13000_low_33 (Length: 240)
Name: NF13000_low_33
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13000_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 76 - 229
Target Start/End: Complemental strand, 26453425 - 26453251
Alignment:
| Q |
76 |
atttagattgaattttatgtttgatattcttattgttttaatgactttcttaataatctttt---------------------attccttaacatatttc |
154 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26453425 |
attttgattgaattttatgtttgatattcttattgttttaatggctttcttaataatcttttgcgctttccatttttttttttattccttaacatatttc |
26453326 |
T |
 |
| Q |
155 |
aatgtttgatcttggcgaggtgaaggaatatgattggaattactgatcaagaagaagtctcaatattttcttcga |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453325 |
aatgtttgatcttggtgaggtgaaggaatatgattggaattactgatcaagaagaagtctcaatattttcttcga |
26453251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 26453581 - 26453517
Alignment:
| Q |
17 |
atatctcactatgatgttgaagaagacaatgttgtttgttttagcctctcttcaatgccatttag |
81 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453581 |
atatctcattatgatgttgaagaagacaatgttgtttgttttagcctctcttcaatgccatttag |
26453517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University