View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13001_high_2 (Length: 278)
Name: NF13001_high_2
Description: NF13001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13001_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 28 - 255
Target Start/End: Original strand, 36292004 - 36292231
Alignment:
| Q |
28 |
cctgcatgatagattaaaacaaactaaaagaaagacaattccagaattgactacaaccattaacactcatcaagcacagcttctagttatctccataatt |
127 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36292004 |
cctgcatgatagattaatacaaactaaaagaaagacaattccagaattgactccaacccttaacactcatcaagcactgcttctagttatctccataatt |
36292103 |
T |
 |
| Q |
128 |
tccaatcctgtccataatgtttgccacggtctctttgctttctttcaaaactttcacactcctgctcaacttctgtctcttgcctgacattgaaggagac |
227 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36292104 |
tccaatcctgtccataatgttggccacggtctctttgctttctctcaaaactgtcacactcctgctcaacttctgtctcttgcctgatattgaaggagac |
36292203 |
T |
 |
| Q |
228 |
tcctcaagcagcctctcaacaccaccac |
255 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
36292204 |
tcctcaagcagcctcttaacaccaccac |
36292231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 107 - 249
Target Start/End: Original strand, 36311499 - 36311641
Alignment:
| Q |
107 |
cttctagttatctccataatttccaatcctgtccataatgtttgccacggtctctttgctttctttcaaaactttcacactcctgctcaacttctgtctc |
206 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||| || ||||| ||||| ||||||||| | | |||||||||||| ||||| || | |||||| |
|
|
| T |
36311499 |
cttctagttaacgccatagactccaatcctgtccataatattggccacagtctccttgctttctctaagaactttcacactgctgcttaatctttgtctc |
36311598 |
T |
 |
| Q |
207 |
ttgcctgacattgaaggagactcctcaagcagcctctcaacac |
249 |
Q |
| |
|
|| || || || || ||||| |||||||||||||||||||||| |
|
|
| T |
36311599 |
ttaccagaaatagatggagattcctcaagcagcctctcaacac |
36311641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University