View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13001_low_5 (Length: 259)
Name: NF13001_low_5
Description: NF13001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13001_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 239
Target Start/End: Complemental strand, 43568356 - 43568127
Alignment:
| Q |
14 |
agggtcaagaaatatttgaaagcatgaaaagggattataggttagagccgagattggaacattatggatgtatggttgatcttcttggaagggcaggaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568356 |
agggtcaagaaatatttgaaagcatgaaaagggattataggttagagccgagattggaacattatggatgtatggttgatcttcttggaagggcaggaaa |
43568257 |
T |
|
| Q |
114 |
gttggaagaggcggagaattttattcttgaaatgcctataaaaccaaatgctccagtatgg----ggagcattgctaggagcctgcaggattcacagaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568256 |
gttggaagaggcggagaattttattcttgaaatgcctataaaaccaaatgctccagtatggggagggagcattgctaggagcctgcaggattcacagaaa |
43568157 |
T |
|
| Q |
210 |
tgttgaagttggagaaagggttggaacgat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43568156 |
tgttgaagttggagaaagggttggaacgat |
43568127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 68 - 107
Target Start/End: Original strand, 28405564 - 28405603
Alignment:
| Q |
68 |
tggaacattatggatgtatggttgatcttcttggaagggc |
107 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
28405564 |
tggaacattatggttgtatggttgaccttcttggaagggc |
28405603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University