View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13002_high_7 (Length: 338)
Name: NF13002_high_7
Description: NF13002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13002_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 10 - 325
Target Start/End: Complemental strand, 17233145 - 17232822
Alignment:
| Q |
10 |
agaagaagaaaaaattatttaggatatcggttttggttgtctaacatgtgtcgacgagtatcataggagtgtcggacacggcggcacacctagtcttata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17233145 |
agaagaagaaaaaattatttaggatatcggttttggttgtccaacatgtgttgacgagtatcataggagtgtcggacacggcggcacacctagtcttgta |
17233046 |
T |
|
| Q |
110 |
agtgcttcataattctttcctcactttgacttaagatgtatagctttttattttgtttcgtgaggct----gtgta----annnnnnnaacattttctag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
17233045 |
agtgcttcataattctttcctcactttgacttaagatgtatagctttttattttgtttcgtgaggctgatagtgtaccccctcccccaaacattttctag |
17232946 |
T |
|
| Q |
202 |
ctctcaattattgaattgaacattattattatgatatatctcaagctattaagttgttattcgtaatcttatgatttgatataattcactgtttcaaaaa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17232945 |
ctctcaattattgaattgaacattattattatgatatatctcaagctattaagttgttattcgtaatcttatgatttgatataattcactgtttcaaaaa |
17232846 |
T |
|
| Q |
302 |
catggttccaattttcaatttgat |
325 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
17232845 |
catggttccaattttcaatttgat |
17232822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 24 - 102
Target Start/End: Complemental strand, 32676488 - 32676409
Alignment:
| Q |
24 |
ttatttaggatatcggttttggttgtctaacatgtgtcg-acgagtatcataggagtgtcggacacggcggcacacctag |
102 |
Q |
| |
|
|||||||||| |||||| | | |||| |||| |||||| || ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32676488 |
ttatttaggacatcggtcatagctgtccaacacgtgtcgtacaagtgtcataggagtgtcggacacggcgacacacctag |
32676409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 11411005 - 11411071
Alignment:
| Q |
24 |
ttatttaggatatcggttttggttgtctaacatgtgtc-gacgagtatcataggagtgtcggacacg |
89 |
Q |
| |
|
|||||||||| |||| |||| |||||| ||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
11411005 |
ttatttaggacatcgattttagttgtccgacatgtgtcagacaagtgtcataggagtgtcggacacg |
11411071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University