View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13002_low_11 (Length: 241)
Name: NF13002_low_11
Description: NF13002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13002_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 4 - 144
Target Start/End: Original strand, 16292693 - 16292833
Alignment:
| Q |
4 |
atagtaagttgtttttggtcaaattagaaagtattttggagtttaaggtgaatgtatgtgtccaagcttcccactctattgttactcattgatgtcgcga |
103 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16292693 |
atagtaagttgtttttggtcaaattaaaaggtattttggagtttaaggtgaatgtatgtgtccaagcttcccactctattgttactcgttgatgtcgcga |
16292792 |
T |
 |
| Q |
104 |
ccattttaaagaaaattagacaaagatggagactaaattga |
144 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16292793 |
ccattttaaagaaaattagacaaagatagagactaaattga |
16292833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 165 - 228
Target Start/End: Original strand, 16292822 - 16292885
Alignment:
| Q |
165 |
agactaaattgatggtaaataagtgaaaaagttattaatactctagctccataaagaaacacat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16292822 |
agactaaattgatggtaaataagtgaaaaagttattaatactctagctccataaagaaacacat |
16292885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University