View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13002_low_12 (Length: 235)

Name: NF13002_low_12
Description: NF13002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13002_low_12
NF13002_low_12
[»] chr1 (1 HSPs)
chr1 (13-235)||(8216765-8216987)


Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 8216987 - 8216765
Alignment:
13 aatattggccgagttttgcctcttcgtggtgaaagggtcttttgtctctagaggatatggttggagttgattgattcagtagggaggtggctaggaaaat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
8216987 aatattggccgagttttgcctcttcgtggtgaaagggtcttttgtctctagaggatatggttggagttgattggttcagtagggaggtggctaggaaaat 8216888  T
113 cggaaatgggagaaactcgagtttttggaatgatgcttggagggataccattccattaagtattaaattccctagactttactccatttctaataatcaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8216887 cggaaatgggagaaactcgagtttttggaatgatgcttggagggataccattccattaagtattaaattccctagactttactccatttctaataatcaa 8216788  T
213 gaagcaaaggtgagtgagttgtg 235  Q
    |||||||||||||||||||||||    
8216787 gaagcaaaggtgagtgagttgtg 8216765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University