View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13002_low_13 (Length: 212)
Name: NF13002_low_13
Description: NF13002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13002_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 18 - 122
Target Start/End: Original strand, 1953776 - 1953880
Alignment:
| Q |
18 |
atcattcaagttcttgaagacaaaggaaattccaacgggtttctatgagatcaagactggacatgcaaacattcgtacaccttggtggtaagaatatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1953776 |
atcattcaagttcttgaagacaaaggaaattccaacgggtttttatgagatcaagactggacatgcaaacattcgtacaccttggtggtaagaatatttt |
1953875 |
T |
 |
| Q |
118 |
ccata |
122 |
Q |
| |
|
||||| |
|
|
| T |
1953876 |
ccata |
1953880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 22 - 112
Target Start/End: Original strand, 1939908 - 1939998
Alignment:
| Q |
22 |
ttcaagttcttgaagacaaaggaaattccaacgggtttctatgagatcaagactggacatgcaaacattcgtacaccttggtggtaagaat |
112 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| || ||||||||| || |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1939908 |
ttcaagttcttcaagacaaaggaaatcccaactggcttctatgaggtccagaccggacatgcaaacatccgtacaccttggtggtaagaat |
1939998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 22 - 107
Target Start/End: Original strand, 1924487 - 1924572
Alignment:
| Q |
22 |
ttcaagttcttgaagacaaaggaaattccaacgggtttctatgagatcaagactggacatgcaaacattcgtacaccttggtggta |
107 |
Q |
| |
|
|||||||| ||||||||||||||||| || || || ||| |||| ||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
1924487 |
ttcaagtttttgaagacaaaggaaatgcccactgggttcgatgatatcaagactggacatccaaacatacgcacaccttggtggta |
1924572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 194
Target Start/End: Complemental strand, 44621479 - 44621433
Alignment:
| Q |
148 |
tatcttacttatttataatacgaataacacttttaagaaaatgtgtc |
194 |
Q |
| |
|
|||||||||||||| |||||| ||||||| | ||||||||||||||| |
|
|
| T |
44621479 |
tatcttacttatttctaatactaataacaatgttaagaaaatgtgtc |
44621433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 34509458 - 34509413
Alignment:
| Q |
149 |
atcttacttatttataatacgaataacacttttaagaaaatgtgtc |
194 |
Q |
| |
|
||||||||||||| |||||| ||||||| | ||||||||||||||| |
|
|
| T |
34509458 |
atcttacttatttctaatactaataacaatgttaagaaaatgtgtc |
34509413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 192
Target Start/End: Original strand, 26000017 - 26000061
Alignment:
| Q |
148 |
tatcttacttatttataatacgaataacacttttaagaaaatgtg |
192 |
Q |
| |
|
|||||||||||||| |||||| ||||||| | ||||||||||||| |
|
|
| T |
26000017 |
tatcttacttatttctaatactaataacaatgttaagaaaatgtg |
26000061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University