View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13002_low_14 (Length: 208)
Name: NF13002_low_14
Description: NF13002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13002_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 42 - 190
Target Start/End: Complemental strand, 5400514 - 5400365
Alignment:
| Q |
42 |
tagaattaatttagtaaaatcaattgtagttaaaagtaatttaa-gataaaatggtttacgtacgattcatgtacatgaaaatgaattgaacaagtataa |
140 |
Q |
| |
|
|||||| ||||| ||||||| ||||||| |||||||||| |||| ||||||||| |||| ||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
5400514 |
tagaatgaattttgtaaaattaattgtatttaaaagtaagttaaagataaaatgatttatgtacgattcattttcatgaaaatgaattgaacaagtataa |
5400415 |
T |
|
| Q |
141 |
aaaatgatgtttgtagacacaatttagaaatcatagcttcatgttagaat |
190 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
5400414 |
aaaaacatgtttgtagacaaaatttagaaatcatagctttatgttagaat |
5400365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University