View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13002_low_7 (Length: 343)
Name: NF13002_low_7
Description: NF13002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13002_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 29 - 335
Target Start/End: Original strand, 17233184 - 17233490
Alignment:
| Q |
29 |
caacactcatatgagccgtgtcggacaactcaggcaaaagtctgaaacatctgtgattcccaacatccttgtgtcatttctttgcggtgggtgttgttgc |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
17233184 |
caacactcatatgagccgtgtcggacaactcagataaaagtctgaaacatctgtgattcccaacatcctagtgtcatttctttgtggtgggtgttgttgc |
17233283 |
T |
|
| Q |
129 |
acatattaggcccttatggggttctcattcttattgcttgcggttgcagttcctattcatagtgcactcttcactcttgaaaaatttgccagactgctac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17233284 |
acatattaggcccttatggggttctcattcttattgcttgcggttgcggttcttattcatagtgcactcttcactcttgaaaaatttgccagactgcttc |
17233383 |
T |
|
| Q |
229 |
agagcaacatctgtaaatttctttctagtgttgttatttgagacaataaatacttcatcatgtttattccaaaggattatttctttaaacttttgatcat |
328 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
17233384 |
agagcaacatctgtgaatttctttctagtgttgttatttgagacaataaacacttcatattgtttattccaaaggagtatttctttaaacttttaatcat |
17233483 |
T |
|
| Q |
329 |
attcttc |
335 |
Q |
| |
|
|||||| |
|
|
| T |
17233484 |
tttcttc |
17233490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 17540284 - 17540248
Alignment:
| Q |
30 |
aacactcatatgagccgtgtcggacaactcaggcaaa |
66 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17540284 |
aacactcatatgaaccgtgtcggacaactcagacaaa |
17540248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 26565567 - 26565531
Alignment:
| Q |
30 |
aacactcatatgagccgtgtcggacaactcaggcaaa |
66 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
26565567 |
aacactcatacgagccgtgtcggacaactcagacaaa |
26565531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University