View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13003_high_7 (Length: 283)
Name: NF13003_high_7
Description: NF13003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13003_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 26 - 233
Target Start/End: Complemental strand, 9716516 - 9716309
Alignment:
| Q |
26 |
caactaattattattattatcttcctaacatcaaaagttattgacctttt-acaaaaagtttaatggattatgaatatcagtgttgtctcacctaagtcc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||| ||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
9716516 |
caactaattattattattatcttcctaacatcaaaagttgttgaactttttacaaagagtttaatggattatgaatat-agtgttgtcgcacctaagtcc |
9716418 |
T |
 |
| Q |
125 |
atgatggacatcaagggtaaacatgattaactaatatcatcttcttcattccctcgtttaactctaagcatcttccattcttgcatcttgtgcttttaat |
224 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
9716417 |
atgatggacattaagggtaaacatgattaactaatatcatgttcttcattctctcgtttaactctaagcatcttccattcttgtatcttatgcttttaat |
9716318 |
T |
 |
| Q |
225 |
tactctcga |
233 |
Q |
| |
|
||||||||| |
|
|
| T |
9716317 |
tactctcga |
9716309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University