View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13003_high_9 (Length: 239)
Name: NF13003_high_9
Description: NF13003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13003_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 41298641 - 41298422
Alignment:
| Q |
2 |
taccacacaattgagttcttcagttatttgactcacagacattaacttattagacaatgtaggaacaaggagggtgtgagataaagagagtgatgatgat |
101 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41298641 |
taccacacgattgagttcatcagttatttgactcacagacattaacttattagacaatgtaggaacaaggagggtgtgagataaagagagtgatgatgat |
41298542 |
T |
 |
| Q |
102 |
aatgacacagttccagcgccggtgactgggtatgcaactccatttgcattagaaatgcaagttctacgtggtggagtagaatgagggaaatcgctcgggt |
201 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41298541 |
aatgacacagttccagcgctggtgactgggtatgcaactccatttgcattagaaatgcaagttctacgtggtggagtagaatgagagaaatcgctcgggt |
41298442 |
T |
 |
| Q |
202 |
caaaggtcatatggtctgtt |
221 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
41298441 |
caaaggtcatatggtttgtt |
41298422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University