View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13004_high_13 (Length: 314)
Name: NF13004_high_13
Description: NF13004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13004_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 7 - 202
Target Start/End: Original strand, 32903277 - 32903472
Alignment:
| Q |
7 |
gaagcaaaggtatattttattacacgtcttccttgtggtagtgacgatgcactgtttaaaaagttctaagaagttgtgaattttagtttaatttagtatc |
106 |
Q |
| |
|
||||||||||||| || ||||| | |||||| |||| ||||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32903277 |
gaagcaaaggtatgttccattacgcatcttccctgtgatagtggtgatgcactgtttaaaatgttctaataagttgtgaattttagtttaatttagtatc |
32903376 |
T |
|
| Q |
107 |
aaatttctgttgacaggttgcagattttggtcttgcaaagactgcttctgatctcaatagtcatgtttctactcgagtgatggggactttcgggta |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32903377 |
aaatttctgttgacaggttgctgattttggtcttgcaaagattgcttctgatctcaacactcatgtttctactcgagtgatggggactttcgggta |
32903472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 7 - 202
Target Start/End: Original strand, 32869972 - 32870170
Alignment:
| Q |
7 |
gaagcaaaggtatattttattacacgtcttccttgtggtagtgacgatgcactgtttaaaaagttctaa----gaagttgtgaattttagtttaatttag |
102 |
Q |
| |
|
||||||||||||| || ||||||| ||||| |||||| |||| |||||||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32869972 |
gaagcaaaggtatgttccattacacatcttc-ttgtggcagtggtgatgcactgtttaaaatgttctaataattaagttgtgaatattagtttaatttag |
32870070 |
T |
|
| Q |
103 |
tatcaaatttctgttgacaggttgcagattttggtcttgcaaagactgcttctgatctcaatagtcatgtttctactcgagtgatggggactttcgggta |
202 |
Q |
| |
|
|||| |||||||||||| ||||||| |||||||||||||||||| | | ||||| || | ||| |||||||||| ||||| ||||||||||||||| |
|
|
| T |
32870071 |
tatcgaatttctgttgaaaggttgctgattttggtcttgcaaaggattcacctgattccagcactcacgtttctactcaagtgaaggggactttcgggta |
32870170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University