View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13005_low_6 (Length: 480)
Name: NF13005_low_6
Description: NF13005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13005_low_6 |
 | |
|
| [»] scaffold0352 (3 HSPs) |
| | |
|
| [»] scaffold0237 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0352 (Bit Score: 158; Significance: 7e-84; HSPs: 3)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 158; E-Value: 7e-84
Query Start/End: Original strand, 149 - 387
Target Start/End: Original strand, 16228 - 16463
Alignment:
| Q |
149 |
cataaacttcgaaataattgactacagtgagaatagatcaccaataagggtaaatcgattatgcctcttcnnnnnnnnnnnngggtaaatcaattattga |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16228 |
cataaacttcgaaataattgactacggtgagaatagatcgccaataagtgtaaatcgattatgcctcttcaaaaaaaaa---gggtaaatcaattattga |
16324 |
T |
|
| Q |
249 |
tattaggaaggcgtgataatagagtgaaaaagctgaaaaggtgagcaaagaatttaaagaaacctgttttcaattgactacagttgcaggtgtattattt |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16325 |
tattaggaaggcgtgagaatagagtgaaaaagatgaaagggtgagcaaaaaatttaaaggaacctgttttcaattgactacagttgcaggtgtattgttt |
16424 |
T |
|
| Q |
349 |
ttccttctcaagaaggattagagatctgctttgaataat |
387 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16425 |
ttccttctcaagaaggatttgagatctgctttgaataat |
16463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 385 - 466
Target Start/End: Original strand, 16487 - 16568
Alignment:
| Q |
385 |
aatcaaagcctcaccatcatgaatgagtacacgaaggagagggacgtgagattggaattgagagaaggaatgcagagaaaga |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
16487 |
aatcaaagcctcaccatcatgaatgagtacacgaaggagagggacgtgagatcggaattaagagaaggaatgcagagaaaga |
16568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 16097 - 16162
Alignment:
| Q |
18 |
ataggtgcacaacagctccaaccaccgcaacatcgacatcgtagccaggcttttagcaccactggt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | | |||| ||||||||||| ||||| |
|
|
| T |
16097 |
ataggtgcacaacagctccaaccaccgcaacatcgacaccatcaccagacttttagcaccgctggt |
16162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0237 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0237
Description:
Target: scaffold0237; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 25195 - 25158
Alignment:
| Q |
18 |
ataggtgcacaacagctccaaccaccgcaacatcgaca |
55 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25195 |
ataggtgcacaacagctcgaaccaccgcaacatcgaca |
25158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 29885644 - 29885607
Alignment:
| Q |
18 |
ataggtgcacaacagctccaaccaccgcaacatcgaca |
55 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29885644 |
ataggtgcacaacagctcgaaccaccgcaacatcgaca |
29885607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University