View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_high_50 (Length: 279)
Name: NF13006_high_50
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 5705756 - 5705483
Alignment:
| Q |
1 |
ttagtcaaacctcttttatttatgcgatccgcgattgacatcacagattttgatttcgtagattttttatgcaaatgattataaatctcaaatttattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5705756 |
ttagtcaaacctcttttatttatgcgatccgcgattaacatcacagattttgatttcgtagattttttatgcaaatgattataaatctcaaatttattat |
5705657 |
T |
 |
| Q |
101 |
tttcagtgttacttgaataggatcgatattgagctcatgattctacttcatgattgatttgagctttgagactcaaatgtaacttcgatttgtgttcctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5705656 |
tttcagtgttacttgaataggatcgatattgagctcatgattctacttcatgattgatttgagctttgagactcaaatgtaactttgatttgtgttcctc |
5705557 |
T |
 |
| Q |
201 |
aggttttgagctggaaccctcgcgctttatactttcctaattttgcaagtgcagaacaatgtgatagaataatt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5705556 |
aggttttgagctggaaccctcgcgctttatactttcctaattttgcaagtgcagaacaatgtgatagaataatt |
5705483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 264
Target Start/End: Original strand, 39750053 - 39750116
Alignment:
| Q |
201 |
aggttttgagctggaaccctcgcgctttatactttcctaattttgcaagtgcagaacaatgtga |
264 |
Q |
| |
|
|||||||||||||||| || || ||| | || |||||||||||||||| ||| ||||||||||| |
|
|
| T |
39750053 |
aggttttgagctggaagccacgagctctgtattttcctaattttgcaactgctgaacaatgtga |
39750116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University