View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_high_55 (Length: 258)
Name: NF13006_high_55
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_high_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 48485828 - 48485596
Alignment:
| Q |
8 |
agataatacttctcaattaggtctctgcttggtataatttatgcttatttcacatagaatcaaaattttgagatcttatggggctgaacactgacttagg |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48485828 |
agatactacttctcaattaggtctctgcttggtataatttatgcttatttcacatagaatcaaaattttgagatcttatggggctgaacgatgacttagg |
48485729 |
T |
|
| Q |
108 |
tatgctgtgatggttgtaatgtttgggtgcatgctgagtgtgacaaaatttccagcaaacgtttcaaggtattgtatcatggttaacatggtcctacatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48485728 |
tatgctgtgatggttgtaatgtttgggtgcatgctgagtgtgacaaaatttccagcaaacgtttcaaggtattgtatcatggttaacatggtcctacatc |
48485629 |
T |
|
| Q |
208 |
tctcttttgactattcttttgcttgtttaatgt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48485628 |
tctcttttgactattcttttgcttgtttaatgt |
48485596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 159
Target Start/End: Original strand, 10035087 - 10035141
Alignment:
| Q |
105 |
aggtatgctgtgatggttgtaatgtttgggtgcatgctgagtgtgacaaaatttc |
159 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||||||||||||| || ||||| |
|
|
| T |
10035087 |
aggtatgttgtgatggttgcaatgtatgggtgcatgctgagtgtgataagatttc |
10035141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 177
Target Start/End: Complemental strand, 41531645 - 41531573
Alignment:
| Q |
105 |
aggtatgctgtgatggttgtaatgtttgggtgcatgctgagtgtgacaaaatttccagcaaacgtttcaaggt |
177 |
Q |
| |
|
||||| |||||||||| ||||| || ||||||||||| || |||||||||||||| || || | ||||||||| |
|
|
| T |
41531645 |
aggtacgctgtgatggatgtaaagtgtgggtgcatgccgaatgtgacaaaatttctagtaaccatttcaaggt |
41531573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University