View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_high_58 (Length: 246)
Name: NF13006_high_58
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_high_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 4349269 - 4349368
Alignment:
| Q |
1 |
ttgaaccattaaaataatgtagcactaaataata--------aataaatatctatgcacccacgggttattcaagttctagggttagttgattcaaacac |
92 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4349269 |
ttgaaccattaaaataaagtagcactaaataatatataaataaataaatatctatgcacccacgggttattcaagttctagggttagttgattcaaacac |
4349368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 182
Target Start/End: Original strand, 4349408 - 4349456
Alignment:
| Q |
134 |
caccacgttttcctttctatttcttttccctattacattcactcacatg |
182 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4349408 |
caccacgtttttctttctatttcctttccctattacattcactcacatg |
4349456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 200 - 231
Target Start/End: Original strand, 4349476 - 4349507
Alignment:
| Q |
200 |
cccatcacccttcctcttcaattcatcccttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4349476 |
cccatcacccttcctcttcaattcatcccttt |
4349507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University