View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_high_63 (Length: 238)
Name: NF13006_high_63
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_high_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 31404604 - 31404813
Alignment:
| Q |
12 |
tatgaactcaacctcacaaattctggccacggtttataagtcatcttgaaaatttgattataaaaactgctctaaattggtagcaactaacttgaataat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31404604 |
tatgaactcaacctcacaaattctggccatggtttataagtcatcttgaaaatttgattataaaaactgctctaaattggtagcaactaacttgaataat |
31404703 |
T |
 |
| Q |
112 |
tgaactgtacaagcataatttcacgaccaaattagtttcgatgcttgtgaactatcagtagcagtgtttgaaacactagcctggcactagctttagagat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31404704 |
tgaactgtacaagcataatttcacgaccaaattagtttcgatgcttgtgaactatcagtagcagtgtttgaaccactagcctggcactagctttagagat |
31404803 |
T |
 |
| Q |
212 |
ccagcagaaa |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
31404804 |
ccagcagaaa |
31404813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University