View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_high_64 (Length: 215)
Name: NF13006_high_64
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 7109958 - 7110144
Alignment:
| Q |
15 |
accactttgaagcgttgtatgcatccattaatggatgcttctccaaggaatacattgtccattcaaacaacctccctttgcatgtattacccatgtgcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
7109958 |
accactttgaagcgttgtatgcatccattaatggatgcttttccaaggaatacattgtccattcaaacagcctccatttgcatgtattacccatgtgcaa |
7110057 |
T |
 |
| Q |
115 |
ttatcgcatggcatatgcttttcgttgaaaacttcaagataatgtcgacggcgatcttgaggccatctaaaactacaaaagaataat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7110058 |
ttatcgcatggcatatgcttttcgttgaaaacatcaagataatgacgacggcgatcttgatgccatctaaaactacaaaagaataat |
7110144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 6616134 - 6616089
Alignment:
| Q |
1 |
cccctttatttgctaccactttgaagcgttgtatgcatccattaat |
46 |
Q |
| |
|
||||||| ||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
6616134 |
cccctttctttgcgaccactttgaagtgttgtttgcatccattaat |
6616089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University