View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_high_65 (Length: 211)
Name: NF13006_high_65
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 43 - 192
Target Start/End: Complemental strand, 35165657 - 35165506
Alignment:
| Q |
43 |
tatccgaaatcaaaagaataaataaggatagaagcaaaactaattcaggctcaaatgaaggcattgccattctcccagagctcccacaaga--gagaaat |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35165657 |
tatccgaaatcaaaagaataaataaggatagaagcaaaactaattcaggctcaaatgaaggcattgccattctcccagagctcccacaagagagagaaat |
35165558 |
T |
|
| Q |
141 |
atttctagttgaaatatgagaaaacatacaaggaaagaagggatatacagct |
192 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165557 |
atttctagttcaaatatgagaaaacatacaaggaaagaagggatatacagct |
35165506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University