View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_low_37 (Length: 346)
Name: NF13006_low_37
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 6e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 16 - 136
Target Start/End: Complemental strand, 8527549 - 8527429
Alignment:
| Q |
16 |
acaaactattccaattttgctctccttccttagctttgttgcttttacttgatttgagttttcatatgatttaattaatgtagtttctttcattcatagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8527549 |
acaaactattccaattttgctctccttccttagctttgttgcttttacttgatttgagttttcatatgatttaattaatgtagtttctttcattcatagc |
8527450 |
T |
|
| Q |
116 |
tgttgattttaagatcaaaac |
136 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8527449 |
tgttgattttaagatcaaaac |
8527429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 8627370 - 8627299
Alignment:
| Q |
18 |
aaactattccaattttgctctccttccttagctttgttgcttttacttgatttgagttttcatatgatttaa |
89 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
8627370 |
aaactactccaattatgctctctttccttagctttgttgcttttacttgattggagttttcatataatttaa |
8627299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 8632565 - 8632505
Alignment:
| Q |
16 |
acaaactattccaattttgctctccttccttagctttgttgcttttacttgatttgagttt |
76 |
Q |
| |
|
|||||||||||||||| |||| |||||| ||| |||||||||||||| ||||| ||||||| |
|
|
| T |
8632565 |
acaaactattccaattatgctttccttctttacctttgttgcttttatttgatgtgagttt |
8632505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 90
Target Start/End: Complemental strand, 41439964 - 41439907
Alignment:
| Q |
33 |
tgctctccttccttagctttgttgcttttacttgatttgagttttcatatgatttaat |
90 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
41439964 |
tgctctcattccttagctatgttgcttttatctgatttgagttttcatatgatctaat |
41439907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University