View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_low_45 (Length: 308)
Name: NF13006_low_45
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 2 - 289
Target Start/End: Complemental strand, 2579601 - 2579316
Alignment:
| Q |
2 |
aaagctgtctctagagcacaagaagtatcggaagagactaaaaagctatcaattacagcgcaattagactataaaactagtcgaaaaaacagtagagnnn |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||| |||||||||||||||| ||||||||||| |||| |
|
|
| T |
2579601 |
aaagctgtctctagagcacaagaagtatcggaagagactaaaaggccatcaattacaccgcagttagactataaaactaatcgaaaaaacaataga-aaa |
2579503 |
T |
|
| Q |
102 |
nnnnttacacaatagtctgtaaacaacgcacatggtcgaaccacnnnnnnnn-tagtcgaattttaatcagtccacatctcataatgaattggacaacca |
200 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||| ||| || |||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2579502 |
aaaattacacaacagtttgtaaacaacgcacatggtcaaactaccaaaaaaaatagtcgaattctaatcactccacatttcataatgaattggacaacca |
2579403 |
T |
|
| Q |
201 |
gtggattatacaaaggaattgtgtcacttttcattctcaaagnnnnnnnnntagccttaattaattgaaagatgatcattaccatgttt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2579402 |
gtggattatacaaaggaattgtgtcacttttcattctctaag--aaaaaaataaccttaattaattgaaagatgatcattaccatgttt |
2579316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University