View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_low_57 (Length: 253)
Name: NF13006_low_57
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 11623455 - 11623226
Alignment:
| Q |
7 |
gacactggttaacatttgcctgaaggaaaatgggggtttctttgttttacatgattttggcacactgcagaagaatcaatgcatactgtggctaataatt |
106 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11623455 |
gacactagttaacatttccctgaaggaaaatgggg-tttctttgttttacatgattttggcacactgcagaagaatcaatgcatactgtggctaataatt |
11623357 |
T |
|
| Q |
107 |
cacaatttctctaatcatgaacatcacaagaggaatctcctttttccaaaagattgtaaaagaagtccaaaactagaatataaccacacacaataaacac |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
11623356 |
cacaatttctctaaacatgaacatcacaagaggaatctcctttttccaaaagattgtaaaagaagtccaaaact--aatataaccacacacaatgaacac |
11623259 |
T |
|
| Q |
207 |
ataattagtggataatggatactcttgtcatattcat |
243 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
11623258 |
ataattagtggataatgga----cttgtcatattcat |
11623226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University