View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13006_low_62 (Length: 240)
Name: NF13006_low_62
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13006_low_62 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 38348152 - 38348374
Alignment:
| Q |
18 |
tgtagtaatattcttgttttcttctttggtttttcctttcaattccattggattcttcgccttcctagttctttctatgcttacaaatagtgttaaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348152 |
tgtagtaatattcttgttttcttctttggtttttcctttccattccattggattcttcgccttcctagttctttctatgcttacaaatagtgttaaaatg |
38348251 |
T |
 |
| Q |
118 |
aaagcacatgactttcttgcaccttctcttttttctttctcctttgagttaggtttagatacctgaatctattctctttttcattctttgtgctacaata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348252 |
aaagcacatgactttcttgcaccttctcttttttctttctcctttgagttaggtttagatacctgaatctattctctttttcattctttgtgctacaata |
38348351 |
T |
 |
| Q |
218 |
ggtatttattttctacttctttt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38348352 |
ggtatttattttctacttctttt |
38348374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University