View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13007_low_3 (Length: 233)

Name: NF13007_low_3
Description: NF13007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13007_low_3
NF13007_low_3
[»] chr8 (1 HSPs)
chr8 (119-215)||(16610454-16610550)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 119 - 215
Target Start/End: Original strand, 16610454 - 16610550
Alignment:
119 acaatgaaggaagttgatgagtttgacattgtaattaattagggtaatggattgattaaaactagggttgatttaaggttatggttttgaatatgat 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16610454 acaatgaaggaagttgatgagtttgacattgtaattaattagggtaatggattgattaaaactagggttgatttaaggttatggttttgaatatgat 16610550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University